Rechercher une page de manuel
tqs
Langue: en
Version: 255006 (debian - 07/07/09)
Section: 1 (Commandes utilisateur)
NAME
tqs - Trim Quality Solexa-Illumina SequencesSYNOPSIS
Quality trim solexa-Illumina sequence reads using user-defined thresholds.OPTIONS
- -h, --help
- show this help message and exit
- -f SEQFILE, --sequence file=SEQFILE
- Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
7 1 255 669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC - -q QUALFILE, --qual file=QUALFILE
- A prb file containing all the Illumina intensities, as outputted by the 1G Genome Analyzer (_prb.txt)
- -l MER, --length=MER
- Length of sequence reads (i.e. Number of sequencing cycles, default=36)
- -t THRESHOLD, --threshold=THRESHOLD
- Base intensity threshold value (-40 to 40, default=5)
- -d DIFF, --difference=DIFF
- Base intensity difference between top intensity and second best (1 to 80, default=5)
- -c CONSEC, --consec=CONSEC
- Minimum number of consecutive bases passing threshold values (default=20)
- -v, --verbose
- Runs in Verbose mode.
SEE ALSO
/usr/share/doc/ssake/TQS.readmeAUTHORS
This manual page was written by Andreas Tille <tille@debian.org> for the Debian system (but may be used by others). Permission is granted to copy, distribute and/or modify this document under the terms of the GNU General Public License, Version 2 any later version published by the Free Software Foundation.
On Debian systems, the complete text of the GNU General Public License can be found in /usr/share/common-licenses/GPL.
Contenus ©2006-2024 Benjamin Poulain
Design ©2006-2024 Maxime Vantorre