Rechercher une page de manuel
Bio::Perl.3pm
Langue: en
Version: 2008-01-11 (mandriva - 01/05/08)
Section: 3 (Bibliothèques de fonctions)
NAME
Bio::Perl - Functional access to BioPerl for people who don't know objectsSYNOPSIS
use Bio::Perl;
# will guess file format from extension $seq_object = read_sequence($filename);
# forces genbank format $seq_object = read_sequence($filename,'genbank');
# reads an array of sequences @seq_object_array = read_all_sequences($filename,'fasta');
# sequences are Bio::Seq objects, so the following methods work # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'
print "Sequence name is ",$seq_object->display_id,"\n"; print "Sequence acc is ",$seq_object->accession_number,"\n"; print "First 5 bases is ",$seq_object->subseq(1,5),"\n";
# get the whole sequence as a single string
$sequence_as_a_string = $seq_object->seq();
# writing sequences
write_sequence(">$filename",'genbank',$seq_object);
write_sequence(">$filename",'genbank',@seq_object_array);
# making a new sequence from just a string
$seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA", "myname","AL12232");
# getting a sequence from a database (assumes internet connection)
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
$seq_object = get_sequence('embl',"AI129902");
$seq_object = get_sequence('genbank',"AI129902");
# BLAST a sequence (assummes an internet connection)
$blast_report = blast_sequence($seq_object);
write_blast(">blast.out",$blast_report);
DESCRIPTION
Easy first time access to BioPerl via functions.FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
http://bugzilla.open-bio.org/
AUTHOR - Ewan Birney
Email birney@ebi.ac.ukAPPENDIX
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _read_sequence
Title : read_sequence Usage : $seq = read_sequence('sequences.fa') $seq = read_sequence($filename,'genbank');
# pipes are fine $seq = read_sequence("my_fetching_program $id |",'fasta');
Function: Reads the top sequence from the file. If no format is given, it will try to guess the format from the filename. If a format is given, it forces that format. The filename can be any valid perl open() string - in particular, you can put in pipes
Returns : A Bio::Seq object. A quick synopsis: $seq_object->display_id - name of the sequence $seq_object->seq - sequence as a string
Args : Two strings, first the filename - any Perl open() string is ok Second string is the format, which is optional
For more information on Seq objects see Bio::Seq.
read_all_sequences
Title : read_all_sequences Usage : @seq_object_array = read_all_sequences($filename); @seq_object_array = read_all_sequences($filename,'genbank');
Function: Just as the function above, but reads all the sequences in the file and loads them into an array.
For very large files, you will run out of memory. When this happens, you've got to use the SeqIO system directly (this is not so hard! Don't worry about it!).
Returns : array of Bio::Seq objects
Args : two strings, first the filename (any open() string is ok) second the format (which is optional)
See Bio::SeqIO and Bio::Seq for more information
write_sequence
Title : write_sequence Usage : write_sequence(">new_file.gb",'genbank',$seq) write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
Function: writes sequences in the specified format
Returns : true
Args : filename as a string, must provide an open() output file format as a string one or more sequence objects
new_sequence
Title : new_sequence Usage : $seq_obj = new_sequence("GATTACA", "kino-enzyme");
Function: Construct a sequency object from sequence string Returns : A Bio::Seq object
Args : sequence string name string (optional, default "no-name-for-sequence") accession - accession number (optional, no default)
blast_sequence
Title : blast_sequence Usage : $blast_result = blast_sequence($seq) $blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');
Function: If the computer has Internet accessibility, blasts the sequence using the NCBI BLAST server against nrdb.
It chooses the flavour of BLAST on the basis of the sequence.
This function uses Bio::Tools::Run::RemoteBlast, which itself use Bio::SearchIO - as soon as you want to know more, check out these modules Returns : Bio::Search::Result::GenericResult.pm
Args : Either a string of protein letters or nucleotides, or a Bio::Seq object
write_blast
Title : write_blast Usage : write_blast($filename,$blast_report);
Function: Writes a BLAST result object (or more formally a SearchIO result object) out to a filename in BLAST-like format
Returns : none
Args : filename as a string Bio::SearchIO::Results object
get_sequence
Title : get_sequence Usage : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
Function: If the computer has Internet access this method gets the sequence from Internet accessible databases. Currently this supports Swissprot ('swiss'), EMBL ('embl'), GenBank ('genbank'), GenPept ('genpept'), and RefSeq ('refseq').
Swissprot and EMBL are more robust than GenBank fetching.
If the user is trying to retrieve a RefSeq entry from GenBank/EMBL, the query is silently redirected.
Returns : A Bio::Seq object
Args : database type - one of swiss, embl, genbank, genpept, or refseq
translate
Title : translate Usage : $seqobj = translate($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain string of DNA to amino acids Returns : A Bio::Seq object
Args : Either a sequence object or a string of just DNA sequence characters
translate_as_string
Title : translate_as_string Usage : $seqstring = translate_as_string($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain string of DNA to amino acids Returns : A string of just amino acids
Args : Either a sequence object or a string of just DNA sequence characters
reverse_complement
Title : reverse_complement Usage : $seqobj = reverse_complement($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a Bio::Seq - if you want a string, you can use reverse_complement_as_string Returns : A Bio::Seq object
Args : Either a sequence object or a string of just DNA sequence characters
revcom
Title : revcom Usage : $seqobj = revcom($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a Bio::Seq - if you want a string, you can use reverse_complement_as_string
This is an alias for reverse_complement Returns : A Bio::Seq object
Args : Either a sequence object or a string of just DNA sequence characters
reverse_complement_as_string
Title : reverse_complement_as_string Usage : $string = reverse_complement_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a string Returns : A string of DNA letters
Args : Either a sequence object or a string of just DNA sequence characters
revcom_as_string
Title : revcom_as_string Usage : $string = revcom_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a string Returns : A string of DNA letters
Args : Either a sequence object or a string of just DNA sequence characters
Contenus ©2006-2024 Benjamin Poulain
Design ©2006-2024 Maxime Vantorre