Bio::PrimarySeq.3pm

Langue: en

Version: 2009-03-10 (debian - 07/07/09)

Section: 3 (Bibliothèques de fonctions)

NAME

Bio::PrimarySeq - Bioperl lightweight Sequence Object

SYNOPSIS

   # Bio::SeqIO for file reading, Bio::DB::GenBank for
   # database reading
 
   use Bio::Seq;
   use Bio::SeqIO;
   use Bio::DB::GenBank;
 
   # make from memory
 
   $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
                                    -id  => 'GeneFragment-12',
                                    -accession_number => 'X78121',
                                    -alphabet => 'dna',
                                    -is_circular => 1 );
   print "Sequence ", $seqobj->id(), " with accession ",
     $seqobj->accession_number, "\n";
 
   # read from file
 
   $inputstream = Bio::SeqIO->new(-file => "myseq.fa",
                                  -format => 'Fasta');
   $seqobj = $inputstream->next_seq();
   print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
 
   # to get out parts of the sequence.
 
   print "Sequence ", $seqobj->id(), " with accession ",
     $seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
 
   $string  = $seqobj->seq();
   $string2 = $seqobj->subseq(1,40);
 
 

DESCRIPTION

PrimarySeq is a lightweight Sequence object, storing the sequence, its name, a computer-useful unique name, and other fundamental attributes. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.

Although new users will use Bio::PrimarySeq a lot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).

Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface. If that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish. If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation

The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
   bioperl-l@bioperl.org                  - General discussion
   http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
 
 

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
   http://bugzilla.open-bio.org/
 
 

AUTHOR - Ewan Birney

Email birney@ebi.ac.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

  Title   : new
  Usage   : $seq    = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
                                            -id  => 'human_id',
                                            -accession_number => 'AL000012',
                                            );
 
  Function: Returns a new primary seq object from
            basic constructors, being a string for the sequence
            and strings for id and accession_number.
 
            Note that you can provide an empty sequence string. However, in
            this case you MUST specify the type of sequence you wish to
            initialize by the parameter -alphabet. See alphabet() for possible
            values.
  Returns : a new Bio::PrimarySeq object
  Args    : -seq         => sequence string
            -display_id  => display id of the sequence (locus name)
            -accession_number => accession number
            -primary_id  => primary id (Genbank id)
            -version     => version number
            -namespace   => the namespace for the accession
            -authority   => the authority for the namespace
            -description => description text
            -desc        => alias for description
            -alphabet    => sequence type (alphabet) (dna|rna|protein)
            -id          => alias for display id
            -is_circular => boolean field for whether or not sequence is circular
            -direct      => boolean field for directly setting sequence (requires alphabet also set)
            -ref_to_seq  => boolean field indicating the sequence is a reference (?!?)
            -nowarnonempty => boolean field for whether or not to warn when sequence is empty
 
 

seq

  Title   : seq
  Usage   : $string    = $obj->seq()
  Function: Returns the sequence as a string of letters. The
            case of the letters is left up to the implementer.
            Suggested cases are upper case for proteins and lower case for
            DNA sequence (IUPAC standard), but you should not rely on this.
  Returns : A scalar
  Args    : Optionally on set the new value (a string). An optional second
            argument presets the alphabet (otherwise it will be guessed).
 
 

validate_seq

  Title   : validate_seq
  Usage   : if(! $seq->validate_seq($seq_str) ) {
                 print "sequence $seq_str is not valid for an object of
                 alphabet ",$seq->alphabet, "\n";
            }
  Function: Validates a given sequence string. A validating sequence string
            must be accepted by seq(). A string that does not validate will
            lead to an exception if passed to seq().
 
            The implementation provided here does not take alphabet() into
            account. Allowed are all letters (A-Z) and '-','.','*','?','=',
            and '~'.
 
  Example :
  Returns : 1 if the supplied sequence string is valid for the object, and
            0 otherwise.
  Args    : The sequence string to be validated.
 
 

subseq

  Title   : subseq
  Usage   : $substring = $obj->subseq(10,40);
            $substring = $obj->subseq(10,40,NOGAP)
            $substring = $obj->subseq(-START=>10,-END=>40,-REPLACE_WITH=>'tga')
  Function: returns the subseq from start to end, where the first sequence
            character has coordinate 1 number is inclusive, ie 1-2 are the 
            first two characters of the sequence
  Returns : a string
  Args    : integer for start position
            integer for end position
                  OR
            Bio::LocationI location for subseq (strand honored)
            Specify -NOGAP=>1 to return subseq with gap characters removed
            Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
            with $new_subseq in the sequence object
 
 

length

  Title   : length
  Usage   : $len = $seq->length();
  Function: Get the length of the sequence in number of symbols (bases
            or amino acids).
 
            You can also set this attribute, even to a number that does
            not match the length of the sequence string. This is useful
            if you don''t want to set the sequence too, or if you want
            to free up memory by unsetting the sequence. In the latter
            case you could do e.g.
 
                $seq->length($seq->length);
                $seq->seq(undef);
 
            Note that if you set the sequence to a value other than
            undef at any time, the length attribute will be
            invalidated, and the length of the sequence string will be
            reported again. Also, we won''t let you lie about the length.
 
  Example :
  Returns : integer representing the length of the sequence.
  Args    : Optionally, the value on set
 
 

display_id

  Title   : display_id or display_name
  Usage   : $id_string = $obj->display_id();
  Function: returns the display id, aka the common name of the Sequence object.
 
            The semantics of this is that it is the most likely string to
            be used as an identifier of the sequence, and likely to have
            "human" readability.  The id is equivalent to the ID field of
            the GenBank/EMBL databanks and the id field of the
            Swissprot/sptrembl database. In fasta format, the >(\S+) is
            presumed to be the id, though some people overload the id to
            embed other information. Bioperl does not use any embedded
            information in the ID field, and people are encouraged to use
            other mechanisms (accession field for example, or extending
            the sequence object) to solve this.
 
            With the new Bio::DescribeableI interface, display_name aliases
            to this method.
 
  Returns : A string
  Args    : None
 
 

accession_number

  Title   : accession_number or object_id
  Usage   : $unique_key = $obj->accession_number;
  Function: Returns the unique biological id for a sequence, commonly
            called the accession_number. For sequences from established
            databases, the implementors should try to use the correct
            accession number. Notice that primary_id() provides the
            unique id for the implemetation, allowing multiple objects
            to have the same accession number in a particular implementation.
 
            For sequences with no accession number, this method should
            return "unknown".
 
            [Note this method name is likely to change in 1.3]
 
            With the new Bio::IdentifiableI interface, this is aliased
            to object_id
 
  Returns : A string
  Args    : A string (optional) for setting
 
 

primary_id

  Title   : primary_id
  Usage   : $unique_key = $obj->primary_id;
  Function: Returns the unique id for this object in this
            implementation. This allows implementations to manage their
            own object ids in a way the implementaiton can control
            clients can expect one id to map to one object.
 
            For sequences with no natural primary id, this method
            should return a stringified memory location.
 
  Returns : A string
  Args    : A string (optional, for setting)
 
 

alphabet

  Title   : alphabet
  Usage   : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
  Function: Get/Set the alphabet of sequence, one of
            'dna', 'rna' or 'protein'. This is case sensitive.
 
            This is not called <type> because this would cause
            upgrade problems from the 0.5 and earlier Seq objects.
 
  Returns : a string either 'dna','rna','protein'. NB - the object must
            make a call of the type - if there is no alphabet specified it
            has to guess.
  Args    : optional string to set : 'dna' | 'rna' | 'protein'
 
 

desc

  Title   : desc or description
  Usage   : $obj->desc($newval)
  Function: Get/set description of the sequence.
 
            'description' is an alias for this for compliance with the
            Bio::DescribeableI interface.
 
  Example :
  Returns : value of desc (a string)
  Args    : newvalue (a string or undef, optional)
 
 

can_call_new

  Title   : can_call_new
  Usage   :
  Function:
  Example :
  Returns : true
  Args    :
 
 

id

  Title   : id
  Usage   : $id = $seq->id()
  Function: This is mapped on display_id
  Example :
  Returns :
  Args    :
 
 

is_circular

  Title   : is_circular
  Usage   : if( $obj->is_circular) { /Do Something/ }
  Function: Returns true if the molecule is circular
  Returns : Boolean value
  Args    : none
 
 

Methods for Bio::IdentifiableI compliance

object_id

  Title   : object_id
  Usage   : $string    = $obj->object_id()
  Function: A string which represents the stable primary identifier
            in this namespace of this object. For DNA sequences this
            is its accession_number, similarly for protein sequences.
 
            This is aliased to accession_number().
  Returns : A scalar
 
 

version

  Title   : version
  Usage   : $version    = $obj->version()
  Function: A number which differentiates between versions of
            the same object. Higher numbers are considered to be
            later and more relevant, but a single object described
            the same identifier should represent the same concept.
 
  Returns : A number
 
 

authority

  Title   : authority
  Usage   : $authority    = $obj->authority()
  Function: A string which represents the organisation which
            granted the namespace, written as the DNS name for
            organisation (eg, wormbase.org).
 
  Returns : A scalar
 
 

namespace

  Title   : namespace
  Usage   : $string    = $obj->namespace()
  Function: A string representing the name space this identifier
            is valid in, often the database name or the name
            describing the collection.
 
  Returns : A scalar
 
 

Methods for Bio::DescribableI compliance

This comprises of display_name and description.

display_name

  Title   : display_name
  Usage   : $string    = $obj->display_name()
  Function: A string which is what should be displayed to the user.
            The string should have no spaces (ideally, though a cautious
            user of this interface would not assumme this) and should be
            less than thirty characters (though again, double checking
            this is a good idea).
 
            This is aliased to display_id().
  Returns : A scalar
 
 

description

  Title   : description
  Usage   : $string    = $obj->description()
  Function: A text string suitable for displaying to the user a
            description. This string is likely to have spaces, but
            should not have any newlines or formatting - just plain
            text. The string should not be greater than 255 characters
            and clients can feel justified at truncating strings at 255
            characters for the purposes of display.
 
            This is aliased to desc().
  Returns : A scalar
 
 

Methods Inherited from Bio::PrimarySeqI

These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI

revcom

  Title   : revcom
  Usage   : $rev = $seq->revcom()
  Function: Produces a new Bio::SeqI implementing object which
            is the reversed complement of the sequence. For protein
            sequences this throws an exception of
            "Sequence is a protein. Cannot revcom".
 
            The id is the same id as the orginal sequence, and the
            accession number is also indentical. If someone wants to
            track that this sequence has be reversed, it needs to
            define its own extensions.
 
            To do an inplace edit of an object you can go:
 
            $seqobj = $seqobj->revcom();
 
            This of course, causes Perl to handle the garbage
            collection of the old object, but it is roughly speaking as
            efficient as an inplace edit.
 
  Returns : A new (fresh) Bio::SeqI object
  Args    : none
 
 

trunc

  Title   : trunc
  Usage   : $subseq = $myseq->trunc(10,100);
  Function: Provides a truncation of a sequence,
 
  Example :
  Returns : A fresh Bio::SeqI implementing object.
  Args    :
 
 

Internal methods

These are internal methods to PrimarySeq

_guess_alphabet

  Title   : _guess_alphabet
  Usage   :
  Function: Determines (and sets) the type of sequence: dna, rna, protein
  Example :
  Returns : one of strings 'dna', 'rna' or 'protein'.
  Args    : none