Bio::Tools::Run::StandAloneNCBIBlast.3pm

Langue: en

Version: 2009-03-10 (debian - 07/07/09)

Section: 3 (Bibliothèques de fonctions)

NAME

Bio::Tools::Run::StandAloneNCBIBlast - Object for the local execution of the NCBI BLAST program suite (blastall, blastpgp, bl2seq). With experimental support for NCBI rpsblast.

SYNOPSIS

  # Do not use directly; see Bio::Tools::Run::StandAloneBlast
 
 

DESCRIPTION

See Bio::Tools::Run::StandAloneBlast

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
   bioperl-l@bioperl.org                  - General discussion
   http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
 
 

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
   http://bugzilla.open-bio.org/
 
 

AUTHOR - Peter Schattner

Email schattner at alum.mit.edu

MAINTAINER - Torsten Seemann

Email torsten at infotech.monash.edu.au

CONTRIBUTORS

Sendu Bala bix@sendu.me.uk (reimplementation)

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

  Title   : new
  Usage   : my $obj = Bio::Tools::Run::StandAloneBlast->new();
  Function: Builds a newBio::Tools::Run::StandAloneBlast object 
  Returns : Bio::Tools::Run::StandAloneBlast
  Args    : -quiet => boolean # make program execution quiet
            -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
                            # the parsing method, case insensitive
 
 

Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional except for -p in those programs that have it. For a complete listing of settable parameters, run the relevant executable BLAST program with the option ``-'' as in blastall - Note that the input paramters (-i, -j, -input) should not be set directly by you: this module sets them when you call one of the executable methods.

Blastall

   -p  Program Name [String]
         Input should be one of "blastp", "blastn", "blastx", 
         "tblastn", or "tblastx".
   -d  Database [String] default = nr
         The database specified must first be formatted with formatdb.
         Multiple database names (bracketed by quotations) will be accepted.
         An example would be -d "nr est"
   -e  Expectation value (E) [Real] default = 10.0
   -o  BLAST report Output File [File Out]  Optional,
             default = ./blastreport.out ; set by StandAloneBlast.pm             
   -S  Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
             default = 3
 
 

Blastpgp (including Psiblast)

   -j  is the maximum number of rounds (default 1; i.e., regular BLAST)
   -h  is the e-value threshold for including sequences in the
             score matrix model (default 0.001)
   -c  is the "constant" used in the pseudocount formula specified in the paper (default 10)
   -B  Multiple alignment file for PSI-BLAST "jump start mode"  Optional
   -Q  Output File for PSI-BLAST Matrix in ASCII [File Out]  Optional
 
 

rpsblast

   -d  Database [String] default = (none - you must specify a database)
         The database specified must first be formatted with formatdb.
         Multiple database names (bracketed by quotations) will be accepted.
         An example would be -d "Cog Smart"
   -e  Expectation value (E) [Real] default = 10.0
   -o  BLAST report Output File [File Out]  Optional,
             default = ./blastreport.out ; set by StandAloneBlast.pm
 
 

Bl2seq

   -p  Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
     default = blastp
   -o  alignment output file [File Out] default = stdout
   -e  Expectation value (E) [Real]  default = 10.0
   -S  Query strands to search against database (blastn only).  3 is both, 1 is top, 2 is bottom [Integer]
     default = 3
 
 

blastall

  Title   : blastall
  Usage   :  $blast_report = $factory->blastall('t/testquery.fa');
         or
                $input = Bio::Seq->new(-id=>"test query",
                                       -seq=>"ACTACCCTTTAAATCAGTGGGGG");
                $blast_report = $factory->blastall($input);
         or 
               $seq_array_ref = \@seq_array;  
          # where @seq_array is an array of Bio::Seq objects
               $blast_report = $factory->blastall($seq_array_ref);
  Returns : Reference to a Blast object containing the blast report.
  Args    : Name of a file or Bio::Seq object or an array of 
            Bio::Seq object containing the query sequence(s). 
            Throws an exception if argument is not either a string 
            (eg a filename) or a reference to a Bio::Seq object 
            (or to an array of Seq objects).  If argument is string, 
            throws exception if file corresponding to string name can 
            not be found.
 
 

blastpgp

  Title   : blastpgp
  Usage   :  $blast_report = $factory-> blastpgp('t/testquery.fa');
         or
                $input = Bio::Seq->new(-id=>"test query",
                                       -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
                $blast_report = $factory->blastpgp ($input);
         or
               $seq_array_ref = \@seq_array;  
          # where @seq_array is an array of Bio::Seq objects
               $blast_report = $factory-> blastpgp(\@seq_array);
  Returns : Reference to a Bio::SearchIO object containing the blast report 
  Args    : Name of a file or Bio::Seq object. In psiblast jumpstart 
            mode two additional arguments are required: a SimpleAlign 
            object one of whose elements is the query and a "mask" to 
            determine how BLAST should select scoring matrices see 
            DESCRIPTION above for more details.
 
            Throws an exception if argument is not either a string 
            (eg a filename) or a reference to a Bio::Seq object 
            (or to an array of Seq objects).  If argument is string, 
            throws exception if file corresponding to string name can 
            not be found.
  Returns : Reference to Bio::SearchIO object containing the blast report.
 
 

rpsblast

  Title   : rpsblast
  Usage   :  $blast_report = $factory->rpsblast('t/testquery.fa');
         or
                $input = Bio::Seq->new(-id=>"test query",
                                       -seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG");
                $blast_report = $factory->rpsblast($input);
         or
               $seq_array_ref = \@seq_array;  
          # where @seq_array is an array of Bio::Seq objects
               $blast_report = $factory->rpsblast(\@seq_array);
  Args    : Name of a file or Bio::Seq object or an array of 
            Bio::Seq object containing the query sequence(s). 
            Throws an exception if argument is not either a string 
            (eg a filename) or a reference to a Bio::Seq object 
            (or to an array of Seq objects).  If argument is string, 
            throws exception if file corresponding to string name can 
            not be found.
  Returns : Reference to a Bio::SearchIO object containing the blast report
 
 

bl2seq

  Title   : bl2seq
  Usage   : $factory-> bl2seq('t/seq1.fa', 't/seq2.fa');
         or
           $input1 = Bio::Seq->new(-id=>"test query1",
                                   -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
           $input2 = Bio::Seq->new(-id=>"test query2",
                                   -seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
           $blast_report = $factory->bl2seq ($input1,  $input2);
  Returns : Reference to a BPbl2seq object containing the blast report.
  Args    : Names of 2 files  or 2 Bio::Seq objects containing the 
            sequences to be aligned by bl2seq.
 
            Throws an exception if argument is not either a pair of 
            strings (eg filenames) or references to Bio::Seq objects.  
            If arguments are strings, throws exception if files 
            corresponding to string names can not be found.
 
 

_generic_local_blast

  Title   : _generic_local_blast
  Usage   : internal function not called directly
  Returns : Bio::SearchIO 
  Args    : Reference to calling object and name of BLAST executable
 
 

_runblast

  Title   :  _runblast
  Usage   :  Internal function, not to be called directly        
  Function:   makes actual system call to Blast program
  Example :
  Returns : Report Bio::SearchIO object in the appropriate format 
  Args    : Reference to calling object, name of BLAST executable, 
            and parameter string for executable
 
 

_setparams

  Title   : _setparams
  Usage   : Internal function, not to be called directly 
  Function: Create parameter inputs for Blast program
  Example :
  Returns : parameter string to be passed to Blast 
  Args    : Reference to calling object and name of BLAST executable